RNAscope:Article Title: Stereotyped transcriptomic transformation of somatosensory neurons in response to injury
Article Snippet: Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Gene (Mus musculus) Atf3 NA ENSMUS G00000026628 Strain, strain background (Mus musculus) C57BL/6 Charles River Strain code: 027 Genetic reagent (Mus musculus) Atf3-IRES-Cre This paper Knockin mouse; details Figure 6— figure supplement 1 Genetic reagent (Mus musculus) TetO-mCherry2A-Gnaq* This paper Random insertion transgene (See Materials and methods) Genetic reagent (Mus musculus) Fos-tTA The Jackson Laboratory JAX: 018306 Reijmers et al., 2007 Genetic reagent (Adeno-associated virus) AAV9-CAG-FLEXtdTomato-WPRE Addgene; Oh et al., 2014 Addgene: 51503-AAV9 2.1 10̂13 GC/ml Antibody Anti-NeuN (rabbit polyclonal) Millipore Cat#ABN78; RRID:AB_10807945 (1:2000) Sequencebased reagent crRNA Dharmacon Inc. Edit-R Modified Synthetic crRNA Target sequence: GCAGAAGTGTCTACCTTGAT Peptide, recombinant protein Cas9 PNA Bio Inc. CP01 Commercial assay or kit RNAscope multiplex fluorescent development kit Advanced Cell Diagnostics ACD: 320851 Commercial assay or kit RNAscope probe-Mm-S100b Advanced Cell Diagnostics ACD: 431731 Commercial assay or kit RNAscope probe-Mm-Slit2 Advanced Cell Diagnostics ACD: 449691 Commercial assay or kit RNAscope probe-Mm-Ntng1 Advanced Cell Diagnostics ACD: 488871 Commercial assay or kit RNAscope probe-Mm-Rgs6 Advanced Cell Diagnostics ACD: 521211 Commercial assay or kit RNAscope probe-Mm-Cacna1h Advanced Cell Diagnostics ACD: 459751 Continued on next page Nguyen et al. eLife 2019;8:e49679. .. DOI: https://doi.org/10.7554/eLife.49679 14 of 22 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit RNAscope probe-Mm-Scn5a Advanced Cell Diagnostics ACD: 429881 Commercial assay or kit RNAscope probe-Mm-Htr3a Advanced Cell Diagnostics ACD: 411141 Commercial assay or kit RNAscope probe-Mm-Mrgprd Advanced Cell Diagnostics ACD: 417921 Commercial assay or kit RNAscope probe-Mm-Scn10a Advanced Cell Diagnostics ACD: 426011 Commercial assay or kit RNAscope probe-Mm-Atf3 Advanced Cell Diagnostics ACD: 426891 Commercial assay or kit RNAscope probe-Mm-TrpV1 Advanced Cell Diagnostics ACD: 313331 Commercial assay or kit RNAscope probe-Mm-Tac1 Advanced Cell Diagnostics ACD: 410351 commercial assay or kit RNAscope probe-Mm-Calca Advanced Cell Diagnostics ACD: 420361 Commercial assay or kit RNAscope probe-Mm-Grik1 Advanced Cell Diagnostics ACD: 438771 Commercial assay or kit RNAscope probe-Mm-Piezo2 Advanced Cell Diagnostics ACD: 400191 Commercial assay or kit RNAscope probe-Mm-Gal Advanced Cell Diagnostics ACD: 400961 Commercial assay or kit RNAscope probe-Mm-Nts Advanced Cell Diagnostics ACD: 420441 Commercial assay or kit RNAscope probe-Mm-Npy Advanced Cell Diagnostics ACD: 313321 Commercial assay or kit RNAscope probe-Mm-Sox11 Advanced Cell Diagnostics ACD: 440811 Commercial assay or kit RNAscope probe-Mm-Sema6a Advanced Cell Diagnostics ACD: 508101 Commercial assay or kit RNAscope probe-Mm-Csf1 Advanced Cell Diagnostics ACD: 315621 Commercial assay or kit RNAscope probe-TdTomato Advanced Cell Diagnostics ACD: 317041 Commercial assay or kit RNAscope probe-Fos Advanced Cell Diagnostics ACD: 316921 Commercial assay or kit RNAscope probe-Egr1 Advanced Cell Diagnostics ACD: 423371 Commercial assay or kit Chromium single cell 3’ reagent kit (v2) 10X Genomics Cat# 120237 Commercial assay or kit Chromium i7 Multiplex Kit, 96 rxns 10x Genomics Cat# 120262 Commercial assay or kit Chromium Single Cell A Chip Kit 10x Genomics Cat# 120236 Software, algorithm Seurat Butler et al., 2018; Stuart et al., 2018 RRID:SCR_016341 https://satijalab.org/ Software, algorithm CellRanger 10x Genomics Software, algorithm Drop-seq McCarroll Lab http://mccarrolllab. org/dropseq/ Software, algorithm R R Project for Statistical Computing RRID:SCR_001905 http://www.r-project.org/ Continued on next page Nguyen et al. eLife 2019;8:e49679. .. DOI: https://doi.org/10.7554/eLife.49679 15 of 22 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Software, algorithm R Studio R Studio rstudio.com Software, algorithm Prism v8 GraphPad RRID:SCR_002798 Software, algorithm PhotoShop CC Adobe RRID:SCR_014199 Other RNAlater ThermoFisher Cat# AM7021 Other Glass dounce homogenizer Fisher Scientific Cat# 357538 Other 40 mm cell strainer ThermoFisher Cat# 08-771-1 Other SUPERaseIn RNase Inhibitor ThermoFisher Cat# AM2696 0.2 U/ml Other Anti-rabbit IgG microbeads Miltenyi Biotec Cat# 130-048-602 Other LS columns Miltenyi Biotec Cat# 130-042-401 Other MACS MultiStand Miltenyi Biotec Cat# 130-042-303 Other MidiMACS Separator Miltenyi Biotec Cat# 130-042-302 Other Ultra-Turrax T10 Laboratory Supply Network, Inc. IKA:3737001 Other Dispersing element S10N-5G for Ultra-Turrax T10 Laboratory Supply Network, Inc. IKA:3304000 Mice, surgery and viral transduction Animal experiments were carried out in strict accordance with the US National Institutes of Health (NIH) guidelines for the care and use of laboratory animals and were approved by the NIDCR ACUC.
Single Cell:Article Title: Stereotyped transcriptomic transformation of somatosensory neurons in response to injury
Article Snippet: Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Gene (Mus musculus) Atf3 NA ENSMUS G00000026628 Strain, strain background (Mus musculus) C57BL/6 Charles River Strain code: 027 Genetic reagent (Mus musculus) Atf3-IRES-Cre This paper Knockin mouse; details Figure 6— figure supplement 1 Genetic reagent (Mus musculus) TetO-mCherry2A-Gnaq* This paper Random insertion transgene (See Materials and methods) Genetic reagent (Mus musculus) Fos-tTA The Jackson Laboratory JAX: 018306 Reijmers et al., 2007 Genetic reagent (Adeno-associated virus) AAV9-CAG-FLEXtdTomato-WPRE Addgene; Oh et al., 2014 Addgene: 51503-AAV9 2.1 10̂13 GC/ml Antibody Anti-NeuN (rabbit polyclonal) Millipore Cat#ABN78; RRID:AB_10807945 (1:2000) Sequencebased reagent crRNA Dharmacon Inc. Edit-R Modified Synthetic crRNA Target sequence: GCAGAAGTGTCTACCTTGAT Peptide, recombinant protein Cas9 PNA Bio Inc. CP01 Commercial assay or kit RNAscope multiplex fluorescent development kit Advanced Cell Diagnostics ACD: 320851 Commercial assay or kit RNAscope probe-Mm-S100b Advanced Cell Diagnostics ACD: 431731 Commercial assay or kit RNAscope probe-Mm-Slit2 Advanced Cell Diagnostics ACD: 449691 Commercial assay or kit RNAscope probe-Mm-Ntng1 Advanced Cell Diagnostics ACD: 488871 Commercial assay or kit RNAscope probe-Mm-Rgs6 Advanced Cell Diagnostics ACD: 521211 Commercial assay or kit RNAscope probe-Mm-Cacna1h Advanced Cell Diagnostics ACD: 459751 Continued on next page Nguyen et al. eLife 2019;8:e49679. .. DOI: https://doi.org/10.7554/eLife.49679 14 of 22 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit RNAscope probe-Mm-Scn5a Advanced Cell Diagnostics ACD: 429881 Commercial assay or kit RNAscope probe-Mm-Htr3a Advanced Cell Diagnostics ACD: 411141 Commercial assay or kit RNAscope probe-Mm-Mrgprd Advanced Cell Diagnostics ACD: 417921 Commercial assay or kit RNAscope probe-Mm-Scn10a Advanced Cell Diagnostics ACD: 426011 Commercial assay or kit RNAscope probe-Mm-Atf3 Advanced Cell Diagnostics ACD: 426891 Commercial assay or kit RNAscope probe-Mm-TrpV1 Advanced Cell Diagnostics ACD: 313331 Commercial assay or kit RNAscope probe-Mm-Tac1 Advanced Cell Diagnostics ACD: 410351 commercial assay or kit RNAscope probe-Mm-Calca Advanced Cell Diagnostics ACD: 420361 Commercial assay or kit RNAscope probe-Mm-Grik1 Advanced Cell Diagnostics ACD: 438771 Commercial assay or kit RNAscope probe-Mm-Piezo2 Advanced Cell Diagnostics ACD: 400191 Commercial assay or kit RNAscope probe-Mm-Gal Advanced Cell Diagnostics ACD: 400961 Commercial assay or kit RNAscope probe-Mm-Nts Advanced Cell Diagnostics ACD: 420441 Commercial assay or kit RNAscope probe-Mm-Npy Advanced Cell Diagnostics ACD: 313321 Commercial assay or kit RNAscope probe-Mm-Sox11 Advanced Cell Diagnostics ACD: 440811 Commercial assay or kit RNAscope probe-Mm-Sema6a Advanced Cell Diagnostics ACD: 508101 Commercial assay or kit RNAscope probe-Mm-Csf1 Advanced Cell Diagnostics ACD: 315621 Commercial assay or kit RNAscope probe-TdTomato Advanced Cell Diagnostics ACD: 317041 Commercial assay or kit RNAscope probe-Fos Advanced Cell Diagnostics ACD: 316921 Commercial assay or kit RNAscope probe-Egr1 Advanced Cell Diagnostics ACD: 423371 Commercial assay or kit Chromium single cell 3’ reagent kit (v2) 10X Genomics Cat# 120237 Commercial assay or kit Chromium i7 Multiplex Kit, 96 rxns 10x Genomics Cat# 120262 Commercial assay or kit Chromium Single Cell A Chip Kit 10x Genomics Cat# 120236 Software, algorithm Seurat Butler et al., 2018; Stuart et al., 2018 RRID:SCR_016341 https://satijalab.org/ Software, algorithm CellRanger 10x Genomics Software, algorithm Drop-seq McCarroll Lab http://mccarrolllab. org/dropseq/ Software, algorithm R R Project for Statistical Computing RRID:SCR_001905 http://www.r-project.org/ Continued on next page Nguyen et al. eLife 2019;8:e49679. .. DOI: https://doi.org/10.7554/eLife.49679 15 of 22 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Software, algorithm R Studio R Studio rstudio.com Software, algorithm Prism v8 GraphPad RRID:SCR_002798 Software, algorithm PhotoShop CC Adobe RRID:SCR_014199 Other RNAlater ThermoFisher Cat# AM7021 Other Glass dounce homogenizer Fisher Scientific Cat# 357538 Other 40 mm cell strainer ThermoFisher Cat# 08-771-1 Other SUPERaseIn RNase Inhibitor ThermoFisher Cat# AM2696 0.2 U/ml Other Anti-rabbit IgG microbeads Miltenyi Biotec Cat# 130-048-602 Other LS columns Miltenyi Biotec Cat# 130-042-401 Other MACS MultiStand Miltenyi Biotec Cat# 130-042-303 Other MidiMACS Separator Miltenyi Biotec Cat# 130-042-302 Other Ultra-Turrax T10 Laboratory Supply Network, Inc. IKA:3737001 Other Dispersing element S10N-5G for Ultra-Turrax T10 Laboratory Supply Network, Inc. IKA:3304000 Mice, surgery and viral transduction Animal experiments were carried out in strict accordance with the US National Institutes of Health (NIH) guidelines for the care and use of laboratory animals and were approved by the NIDCR ACUC.
Multiplex Assay:Article Title: Stereotyped transcriptomic transformation of somatosensory neurons in response to injury
Article Snippet: Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Gene (Mus musculus) Atf3 NA ENSMUS G00000026628 Strain, strain background (Mus musculus) C57BL/6 Charles River Strain code: 027 Genetic reagent (Mus musculus) Atf3-IRES-Cre This paper Knockin mouse; details Figure 6— figure supplement 1 Genetic reagent (Mus musculus) TetO-mCherry2A-Gnaq* This paper Random insertion transgene (See Materials and methods) Genetic reagent (Mus musculus) Fos-tTA The Jackson Laboratory JAX: 018306 Reijmers et al., 2007 Genetic reagent (Adeno-associated virus) AAV9-CAG-FLEXtdTomato-WPRE Addgene; Oh et al., 2014 Addgene: 51503-AAV9 2.1 10̂13 GC/ml Antibody Anti-NeuN (rabbit polyclonal) Millipore Cat#ABN78; RRID:AB_10807945 (1:2000) Sequencebased reagent crRNA Dharmacon Inc. Edit-R Modified Synthetic crRNA Target sequence: GCAGAAGTGTCTACCTTGAT Peptide, recombinant protein Cas9 PNA Bio Inc. CP01 Commercial assay or kit RNAscope multiplex fluorescent development kit Advanced Cell Diagnostics ACD: 320851 Commercial assay or kit RNAscope probe-Mm-S100b Advanced Cell Diagnostics ACD: 431731 Commercial assay or kit RNAscope probe-Mm-Slit2 Advanced Cell Diagnostics ACD: 449691 Commercial assay or kit RNAscope probe-Mm-Ntng1 Advanced Cell Diagnostics ACD: 488871 Commercial assay or kit RNAscope probe-Mm-Rgs6 Advanced Cell Diagnostics ACD: 521211 Commercial assay or kit RNAscope probe-Mm-Cacna1h Advanced Cell Diagnostics ACD: 459751 Continued on next page Nguyen et al. eLife 2019;8:e49679. .. DOI: https://doi.org/10.7554/eLife.49679 14 of 22 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit RNAscope probe-Mm-Scn5a Advanced Cell Diagnostics ACD: 429881 Commercial assay or kit RNAscope probe-Mm-Htr3a Advanced Cell Diagnostics ACD: 411141 Commercial assay or kit RNAscope probe-Mm-Mrgprd Advanced Cell Diagnostics ACD: 417921 Commercial assay or kit RNAscope probe-Mm-Scn10a Advanced Cell Diagnostics ACD: 426011 Commercial assay or kit RNAscope probe-Mm-Atf3 Advanced Cell Diagnostics ACD: 426891 Commercial assay or kit RNAscope probe-Mm-TrpV1 Advanced Cell Diagnostics ACD: 313331 Commercial assay or kit RNAscope probe-Mm-Tac1 Advanced Cell Diagnostics ACD: 410351 commercial assay or kit RNAscope probe-Mm-Calca Advanced Cell Diagnostics ACD: 420361 Commercial assay or kit RNAscope probe-Mm-Grik1 Advanced Cell Diagnostics ACD: 438771 Commercial assay or kit RNAscope probe-Mm-Piezo2 Advanced Cell Diagnostics ACD: 400191 Commercial assay or kit RNAscope probe-Mm-Gal Advanced Cell Diagnostics ACD: 400961 Commercial assay or kit RNAscope probe-Mm-Nts Advanced Cell Diagnostics ACD: 420441 Commercial assay or kit RNAscope probe-Mm-Npy Advanced Cell Diagnostics ACD: 313321 Commercial assay or kit RNAscope probe-Mm-Sox11 Advanced Cell Diagnostics ACD: 440811 Commercial assay or kit RNAscope probe-Mm-Sema6a Advanced Cell Diagnostics ACD: 508101 Commercial assay or kit RNAscope probe-Mm-Csf1 Advanced Cell Diagnostics ACD: 315621 Commercial assay or kit RNAscope probe-TdTomato Advanced Cell Diagnostics ACD: 317041 Commercial assay or kit RNAscope probe-Fos Advanced Cell Diagnostics ACD: 316921 Commercial assay or kit RNAscope probe-Egr1 Advanced Cell Diagnostics ACD: 423371 Commercial assay or kit Chromium single cell 3’ reagent kit (v2) 10X Genomics Cat# 120237 Commercial assay or kit Chromium i7 Multiplex Kit, 96 rxns 10x Genomics Cat# 120262 Commercial assay or kit Chromium Single Cell A Chip Kit 10x Genomics Cat# 120236 Software, algorithm Seurat Butler et al., 2018; Stuart et al., 2018 RRID:SCR_016341 https://satijalab.org/ Software, algorithm CellRanger 10x Genomics Software, algorithm Drop-seq McCarroll Lab http://mccarrolllab. org/dropseq/ Software, algorithm R R Project for Statistical Computing RRID:SCR_001905 http://www.r-project.org/ Continued on next page Nguyen et al. eLife 2019;8:e49679. .. DOI: https://doi.org/10.7554/eLife.49679 15 of 22 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Software, algorithm R Studio R Studio rstudio.com Software, algorithm Prism v8 GraphPad RRID:SCR_002798 Software, algorithm PhotoShop CC Adobe RRID:SCR_014199 Other RNAlater ThermoFisher Cat# AM7021 Other Glass dounce homogenizer Fisher Scientific Cat# 357538 Other 40 mm cell strainer ThermoFisher Cat# 08-771-1 Other SUPERaseIn RNase Inhibitor ThermoFisher Cat# AM2696 0.2 U/ml Other Anti-rabbit IgG microbeads Miltenyi Biotec Cat# 130-048-602 Other LS columns Miltenyi Biotec Cat# 130-042-401 Other MACS MultiStand Miltenyi Biotec Cat# 130-042-303 Other MidiMACS Separator Miltenyi Biotec Cat# 130-042-302 Other Ultra-Turrax T10 Laboratory Supply Network, Inc. IKA:3737001 Other Dispersing element S10N-5G for Ultra-Turrax T10 Laboratory Supply Network, Inc. IKA:3304000 Mice, surgery and viral transduction Animal experiments were carried out in strict accordance with the US National Institutes of Health (NIH) guidelines for the care and use of laboratory animals and were approved by the NIDCR ACUC.
Software:Article Title: Stereotyped transcriptomic transformation of somatosensory neurons in response to injury
Article Snippet: Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Gene (Mus musculus) Atf3 NA ENSMUS G00000026628 Strain, strain background (Mus musculus) C57BL/6 Charles River Strain code: 027 Genetic reagent (Mus musculus) Atf3-IRES-Cre This paper Knockin mouse; details Figure 6— figure supplement 1 Genetic reagent (Mus musculus) TetO-mCherry2A-Gnaq* This paper Random insertion transgene (See Materials and methods) Genetic reagent (Mus musculus) Fos-tTA The Jackson Laboratory JAX: 018306 Reijmers et al., 2007 Genetic reagent (Adeno-associated virus) AAV9-CAG-FLEXtdTomato-WPRE Addgene; Oh et al., 2014 Addgene: 51503-AAV9 2.1 10̂13 GC/ml Antibody Anti-NeuN (rabbit polyclonal) Millipore Cat#ABN78; RRID:AB_10807945 (1:2000) Sequencebased reagent crRNA Dharmacon Inc. Edit-R Modified Synthetic crRNA Target sequence: GCAGAAGTGTCTACCTTGAT Peptide, recombinant protein Cas9 PNA Bio Inc. CP01 Commercial assay or kit RNAscope multiplex fluorescent development kit Advanced Cell Diagnostics ACD: 320851 Commercial assay or kit RNAscope probe-Mm-S100b Advanced Cell Diagnostics ACD: 431731 Commercial assay or kit RNAscope probe-Mm-Slit2 Advanced Cell Diagnostics ACD: 449691 Commercial assay or kit RNAscope probe-Mm-Ntng1 Advanced Cell Diagnostics ACD: 488871 Commercial assay or kit RNAscope probe-Mm-Rgs6 Advanced Cell Diagnostics ACD: 521211 Commercial assay or kit RNAscope probe-Mm-Cacna1h Advanced Cell Diagnostics ACD: 459751 Continued on next page Nguyen et al. eLife 2019;8:e49679. .. DOI: https://doi.org/10.7554/eLife.49679 14 of 22 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit RNAscope probe-Mm-Scn5a Advanced Cell Diagnostics ACD: 429881 Commercial assay or kit RNAscope probe-Mm-Htr3a Advanced Cell Diagnostics ACD: 411141 Commercial assay or kit RNAscope probe-Mm-Mrgprd Advanced Cell Diagnostics ACD: 417921 Commercial assay or kit RNAscope probe-Mm-Scn10a Advanced Cell Diagnostics ACD: 426011 Commercial assay or kit RNAscope probe-Mm-Atf3 Advanced Cell Diagnostics ACD: 426891 Commercial assay or kit RNAscope probe-Mm-TrpV1 Advanced Cell Diagnostics ACD: 313331 Commercial assay or kit RNAscope probe-Mm-Tac1 Advanced Cell Diagnostics ACD: 410351 commercial assay or kit RNAscope probe-Mm-Calca Advanced Cell Diagnostics ACD: 420361 Commercial assay or kit RNAscope probe-Mm-Grik1 Advanced Cell Diagnostics ACD: 438771 Commercial assay or kit RNAscope probe-Mm-Piezo2 Advanced Cell Diagnostics ACD: 400191 Commercial assay or kit RNAscope probe-Mm-Gal Advanced Cell Diagnostics ACD: 400961 Commercial assay or kit RNAscope probe-Mm-Nts Advanced Cell Diagnostics ACD: 420441 Commercial assay or kit RNAscope probe-Mm-Npy Advanced Cell Diagnostics ACD: 313321 Commercial assay or kit RNAscope probe-Mm-Sox11 Advanced Cell Diagnostics ACD: 440811 Commercial assay or kit RNAscope probe-Mm-Sema6a Advanced Cell Diagnostics ACD: 508101 Commercial assay or kit RNAscope probe-Mm-Csf1 Advanced Cell Diagnostics ACD: 315621 Commercial assay or kit RNAscope probe-TdTomato Advanced Cell Diagnostics ACD: 317041 Commercial assay or kit RNAscope probe-Fos Advanced Cell Diagnostics ACD: 316921 Commercial assay or kit RNAscope probe-Egr1 Advanced Cell Diagnostics ACD: 423371 Commercial assay or kit Chromium single cell 3’ reagent kit (v2) 10X Genomics Cat# 120237 Commercial assay or kit Chromium i7 Multiplex Kit, 96 rxns 10x Genomics Cat# 120262 Commercial assay or kit Chromium Single Cell A Chip Kit 10x Genomics Cat# 120236 Software, algorithm Seurat Butler et al., 2018; Stuart et al., 2018 RRID:SCR_016341 https://satijalab.org/ Software, algorithm CellRanger 10x Genomics Software, algorithm Drop-seq McCarroll Lab http://mccarrolllab. org/dropseq/ Software, algorithm R R Project for Statistical Computing RRID:SCR_001905 http://www.r-project.org/ Continued on next page Nguyen et al. eLife 2019;8:e49679. .. DOI: https://doi.org/10.7554/eLife.49679 15 of 22 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Software, algorithm R Studio R Studio rstudio.com Software, algorithm Prism v8 GraphPad RRID:SCR_002798 Software, algorithm PhotoShop CC Adobe RRID:SCR_014199 Other RNAlater ThermoFisher Cat# AM7021 Other Glass dounce homogenizer Fisher Scientific Cat# 357538 Other 40 mm cell strainer ThermoFisher Cat# 08-771-1 Other SUPERaseIn RNase Inhibitor ThermoFisher Cat# AM2696 0.2 U/ml Other Anti-rabbit IgG microbeads Miltenyi Biotec Cat# 130-048-602 Other LS columns Miltenyi Biotec Cat# 130-042-401 Other MACS MultiStand Miltenyi Biotec Cat# 130-042-303 Other MidiMACS Separator Miltenyi Biotec Cat# 130-042-302 Other Ultra-Turrax T10 Laboratory Supply Network, Inc. IKA:3737001 Other Dispersing element S10N-5G for Ultra-Turrax T10 Laboratory Supply Network, Inc. IKA:3304000 Mice, surgery and viral transduction Animal experiments were carried out in strict accordance with the US National Institutes of Health (NIH) guidelines for the care and use of laboratory animals and were approved by the NIDCR ACUC.
|
Advanced Cell Diagnostics Inc is a verified supplier 
Advanced Cell Diagnostics Inc manufactures this product 